Basic Information


ANNInter ID ANNInter13832
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-13555 URS000236ED70_3702
Category siRNA lncRNA
Coordinate 5:16560057-16561558(.)
Interaction Sequence AUGGACGACAUAAAAGGGUAUUGU ACAAUACCCUUUUAUAUUGUUCAU
Interaction Site 1 - 24 42173 - 42196

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network