Basic Information


ANNInter ID ANNInter13370
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-13378 URS0002422197_3702
Category siRNA lncRNA
Coordinate 5:15645779-15651266(.) 5:5448896-5498988(+)
Interaction Sequence GAACAGAUACAAAGUUGCGGGCUU AUGUUCAUCCUUUUGUAUUUGUUC
Interaction Site 1 - 24 30763 - 30786

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network