Basic Information


ANNInter ID ANNInter13052
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-13276 URS00023CFAB8_3702
Category siRNA lncRNA
Coordinate 5:15194481-15195004(.)
Interaction Sequence AAGUGGACCAAUAAGGAAAGAGUG UGCUCUUUGUUUAUUGGUUCAAUC
Interaction Site 1 - 24 79219 - 79242

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network