Basic Information
| ANNInter ID | ANNInter12977 |
|---|---|
| Interaction Type | siRNA - lncRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-13261 | URS0002376F22_3702 |
| Category | siRNA | lncRNA |
| Coordinate | 5:15143650-15144380(.) | 1:25048373-25112753(+) |
| Interaction Sequence | AAUC--GGAUUUGCAUUUUUGGCGGU | CCCGCUAAAAAUGUAAAUCCAUGAUU |
| Interaction Site | 1 - 24 | 50218 - 50243 |