Basic Information
| ANNInter ID |
ANNInter12867 |
| Interaction Type |
siRNA - circRNA |
| Identification Method(s) |
psRNATarget |
Interaction Information
| Type |
ncRNA Interactor 1 |
ncRNA Interactor 2 |
| ncRNA ID |
ath-b10r1-13224 |
ath_circ_040419 |
| Category |
siRNA |
circRNA |
| Coordinate |
5:15023475-15025432(.) |
5:8961199-8962688(.) |
| Interaction Sequence |
AUGUGUGCUUGUUGAUUUCUU |
AAAAAACAAACAAGCACACAA |
| Interaction Site |
1 - 21 |
920 - 940 |
Additional Information
| Unpaired Energy (UPE) |
NA |
| Inhibition Mode |
Cleavage |
| RNAhybrid MFE |
NA |
| IntaRNA MFE |
NA |
| Degradome Support |
No |
| Allen's Score |
NA |
| Category |
NA |
| Sample IDs |
|