Basic Information


ANNInter ID ANNInter12840
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-13219 URS0000A772BF_3702
Category siRNA lncRNA
Coordinate 5:15006505-15006821(.) 5:6920199-6920402(+)
Interaction Sequence ACCGUUGAGAGGUUGAACUUCACU GAUGGAGUUCAUUUUCUUAACGGU
Interaction Site 1 - 24 19 - 42

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network