Basic Information
| ANNInter ID | ANNInter12501 |
|---|---|
| Interaction Type | siRNA - circRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-13089 | ath_circ_051524 |
| Category | siRNA | circRNA |
| Coordinate | 5:14473106-14474016(.) | Pt:107702-113559(.) |
| Interaction Sequence | AAGAGAAAGAGAUAGA--AGAAAUGA | UCGUUUCUAGUCUAUCUCUUUCUAUU |
| Interaction Site | 1 - 24 | 1604 - 1629 |