Basic Information


ANNInter ID ANNInter12418
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-13066 URS00023A0DA1_3702
Category siRNA lncRNA
Coordinate 5:14399292-14400668(.) 1:20773646-20837631(+)
Interaction Sequence AGAAUGAUGUGUCGUCUGCCAUA CAUCGUAUAUGAAACAUUAUUCU
Interaction Site 1 - 23 3898 - 3920

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Translation
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network