Basic Information
| ANNInter ID | ANNInter12160 |
|---|---|
| Interaction Type | siRNA - circRNA |
| Identification Method(s) | CleaveLand4 |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-12984 | ath_circ_028437 |
| Category | siRNA | circRNA |
| Coordinate | 5:14121628-14124456(-) | 3:22274256-22276581(+) |
| Interaction Sequence | AGAGGAGAUAGAAGAUAGAGAAUG | CAUCUCUAUCUCUAUUUCUCUCU |
| Interaction Site | 1 - 24 | 216 - 238 |
Additional Information
| Unpaired Energy (UPE) | NA |
|---|---|
| Inhibition Mode | Cleavage |
| RNAhybrid MFE | NA |
| IntaRNA MFE | NA |
| Degradome Support | Yes |
| Allen's Score | 5 |
| Category | 0 |
| Sample IDs | SRR6041086 |