Basic Information


ANNInter ID ANNInter12023
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-12935 URS0002398F99_3702
Category siRNA lncRNA
Coordinate 5:13916659-13918547(.)
Interaction Sequence AUUUAAACCCGUCAAUUCUAGGAU AUCCUAGAAUUGACGGGUUUAGAU
Interaction Site 1 - 24 53491 - 53514

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network