Basic Information


ANNInter ID ANNInter11888
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-12887 URS0002352A6D_3702
Category siRNA lncRNA
Coordinate 5:13712404-13712918(.) 4:7398144-7421696(+)
Interaction Sequence AUUGGUUCGUGAUUUUGAAAGAGU CUUUUUUUAAAAUCAUGAAUUGAU
Interaction Site 1 - 24 10614 - 10637

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network