Basic Information
| ANNInter ID | ANNInter11461 |
|---|---|
| Interaction Type | siRNA - circRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-12745 | ath_circ_049165 |
| Category | siRNA | circRNA |
| Coordinate | 5:12902599-12961030(.) | Pt:51762-54259(.) |
| Interaction Sequence | AAGGACGA-GAAAACAAUGAAAGGA | UUAUUUUAUUGUUUUUAUCGUCUUU |
| Interaction Site | 1 - 24 | 425 - 449 |