Basic Information


ANNInter ID ANNInter10287
Interaction Type siRNA - circRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-12642 ath_circ_024449
Category siRNA circRNA
Coordinate 5:12214594-12234384(.) 3:14141584-14233245(.)
Interaction Sequence AGCCGGAAUCCGACAGAGCUCUCC GCGGAGUUCUGUUGGGAUCCGGUG
Interaction Site 1 - 24 75655 - 75678

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network