Basic Information


ANNInter ID ANNInter09523
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-12461 URS000241AB84_3702
Category siRNA lncRNA
Coordinate 5:11520335-11525883(.) 2:3497441-3595523(+)
Interaction Sequence AGACGAGAAAUUCUGAAGGAUGGG CUCAUCCUUAAGAAUUUCUCGUCC
Interaction Site 1 - 24 45111 - 45134

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network