Basic Information


ANNInter ID ANNInter09352
Interaction Type siRNA - circRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-12416 ath_circ_041910
Category siRNA circRNA
Coordinate 5:11234078-11235388(.) 5:16689263-16694516(.)
Interaction Sequence UUUGCGACGACAACAGAACACAGU GCUCUGUUCUUUAGUCGUCGCGAA
Interaction Site 1 - 24 3309 - 3332

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network