Basic Information


ANNInter ID ANNInter08986
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-12364 URS00023E8512_3702
Category siRNA lncRNA
Coordinate 5:10935288-10936458(.) 3:10643665-10702419(+)
Interaction Sequence AAGUGCUUCGAUCUCCAAGAAAAU UUUUUCUUGGAUAUUGAGGCAUUC
Interaction Site 1 - 24 52557 - 52580

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network