Basic Information
| ANNInter ID | ANNInter08981 |
|---|---|
| Interaction Type | siRNA - lncRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-12363 | URS0000A767FE_3702 |
| Category | siRNA | lncRNA |
| Coordinate | 5:10933739-10934780(.) | 1:845677-847683(+) |
| Interaction Sequence | UCUCUUAUCAAUGA-----CCGGACC | GGUCCGGCCAGCUCAUUGGUAAGAGA |
| Interaction Site | 1 - 21 | 1753 - 1778 |