Basic Information


ANNInter ID ANNInter08767
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-12297 URS00023C6751_3702
Category siRNA lncRNA
Coordinate 5:10441522-10442022(.) 1:8793023-8813451(+)
Interaction Sequence AACUAAUAGACCACGACUCUGAUU AAUCAGAAAUGUGGUCAAUUAGUG
Interaction Site 1 - 24 957 - 980

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network