Basic Information
| ANNInter ID | ANNInter08123 |
|---|---|
| Interaction Type | siRNA - lncRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-12057 | URS000240CD2D_3702 |
| Category | siRNA | lncRNA |
| Coordinate | 5:9410950-9417970(.) | 5:24121224-24123440(+) |
| Interaction Sequence | AUUCC-AUUACUUUGAACUUGAGAA | AUUUCAGGUUCAAAGUAUUAGGAAU |
| Interaction Site | 1 - 24 | 829 - 853 |