Basic Information
| ANNInter ID | ANNInter07700 |
|---|---|
| Interaction Type | siRNA - lncRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-11905 | URS00023B27DC_3702 |
| Category | siRNA | lncRNA |
| Coordinate | 5:8819766-8820033(.) | 3:10425087-10470193(+) |
| Interaction Sequence | AACUCGGGA-CUGGAAGAAUUUAUU | UUCCAAUUCUUUCGGCUCUCGAGUU |
| Interaction Site | 1 - 24 | 24574 - 24598 |