Basic Information
| ANNInter ID | ANNInter07313 |
|---|---|
| Interaction Type | siRNA - lncRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-11757 | URS00023D186C_3702 |
| Category | siRNA | lncRNA |
| Coordinate | 5:8155707-8156884(.) | 1:9890148-9915454(+) |
| Interaction Sequence | AUACUCUU--GACUUACUUUGAAAAG | CUUCUCAAAGUAAGUCUCAAGAGUAU |
| Interaction Site | 1 - 24 | 19314 - 19339 |