Basic Information
| ANNInter ID | ANNInter07070 |
|---|---|
| Interaction Type | siRNA - circRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-11670 | ath_circ_026965 |
| Category | siRNA | circRNA |
| Coordinate | 5:7647294-7650076(.) | 3:19094840-19221648(.) |
| Interaction Sequence | AGGCUAGACAGAAGAUU-ACAAGAC | AUCUUCUUAAUCUUCUGUUUAGCUU |
| Interaction Site | 1 - 24 | 126605 - 126629 |