Basic Information


ANNInter ID ANNInter06491
Interaction Type siRNA - circRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-11453 ath_circ_023043
Category siRNA circRNA
Coordinate 5:6397921-6398713(.) 3:7340868-7343957(.)
Interaction Sequence AACUUCCGAUGUGGGACAUUGUCC GGACAAUGUCCCACAUCGAAAGUU
Interaction Site 1 - 24 2223 - 2246

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network