Basic Information
| ANNInter ID | ANNInter06106 |
|---|---|
| Interaction Type | siRNA - circRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-1128 | ath_circ_005658 |
| Category | siRNA | circRNA |
| Coordinate | 4:5467911-5471787(.) | 1:12510921-12929767(.) |
| Interaction Sequence | AGAAUGACUCCUCUUGGC--AAUGAU | AUCAUUUCGCAAAUAGGAGUCAUUCU |
| Interaction Site | 1 - 24 | 212642 - 212667 |