Basic Information
| ANNInter ID | ANNInter05048 |
|---|---|
| Interaction Type | siRNA - lncRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-10909 | URS00024167BD_3702 |
| Category | siRNA | lncRNA |
| Coordinate | 5:2441081-2443664(.) | 3:17231786-17323918(+) |
| Interaction Sequence | AGGAAGUAGCCAGUGGAAGU-AGCA | UGUUGAUUUUAAUUGGUUACUUUUU |
| Interaction Site | 1 - 24 | 45721 - 45745 |