Basic Information


ANNInter ID ANNInter04980
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-10881 URS00023DA2B5_3702
Category siRNA lncRNA
Coordinate 5:2305471-2305825(.) 5:4784155-4827497(+)
Interaction Sequence AGGUGAUCUCGAUUGUGUCUGUA AACUUACCCAAUCGGGAUCACCU
Interaction Site 1 - 23 19347 - 19369

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network