Basic Information


ANNInter ID ANNInter04860
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-10836 URS00023E8952_3702
Category siRNA lncRNA
Coordinate 5:1897640-1898365(.) 1:4761175-4810288(+)
Interaction Sequence AUGACCCGUUACUCAGUAGAAAGU ACUUUCUACUGAGUAACGGGUCAU
Interaction Site 1 - 24 24804 - 24827

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network