Basic Information


ANNInter ID ANNInter04797
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-1081 URS00023BE58C_3702
Category siRNA lncRNA
Coordinate 4:5311123-5312341(+) 1:8389406-8391271(+)
Interaction Sequence AAGGUGGAGACUUGUAGACGUAUG CGUACAUCUACAACUCUCCACCAC
Interaction Site 1 - 24 478 - 501

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Translation
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network