Basic Information


ANNInter ID ANNInter04345
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-1061 URS00023BB18B_3702
Category siRNA lncRNA
Coordinate 4:5228310-5228660(.) 3:2844804-2889746(+)
Interaction Sequence AACAAAAGAUCCGGUUGAAAAAUA AAUUUUGUAAUCGGGUCUUUUGUC
Interaction Site 1 - 24 43898 - 43921

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network