Basic Information


ANNInter ID ANNInter03300
Interaction Type siRNA - circRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-10197 ath_circ_050425
Category siRNA circRNA
Coordinate 3:20661038-20661761(.) Pt:90510-148139(.)
Interaction Sequence AAUCAGAUCUUUGGUGUUUCUCGA GAUGGAAUCAUCAAAGAUUUGAUC
Interaction Site 1 - 24 57489 - 57512

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network