Basic Information
| ANNInter ID | ANNInter03076 |
|---|---|
| Interaction Type | siRNA - lncRNA |
| Identification Method(s) | CleaveLand4 |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-10131 | URS000234CBC6_3702 |
| Category | siRNA | lncRNA |
| Coordinate | 3:20200520-20203020(.) | 5:13434498-13435418(+) |
| Interaction Sequence | AGAGCUGUAGACGUACGGGGGUGG | CCACCACCAUAUGUCUACAGCUCC |
| Interaction Site | 2 - 24 | 428 - 450 |
Additional Information
| Unpaired Energy (UPE) | NA |
|---|---|
| Inhibition Mode | Cleavage |
| RNAhybrid MFE | NA |
| IntaRNA MFE | NA |
| Degradome Support | Yes |
| Allen's Score | 3.5 |
| Category | 0 |
| Sample IDs | SRR6041097 |