Basic Information


ANNInter ID ANNInter02884
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-10045 URS00023726D4_3702
Category siRNA lncRNA
Coordinate 3:19621900-19623651(.) 2:17885243-17946654(+)
Interaction Sequence AGACGGGGUUAGAUGAUAGGACGG CCGUCUUAUCAUCUAAUCUUGUUC
Interaction Site 1 - 24 19746 - 19769

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network