Basic Information
| ANNInter ID |
ANNInter02584 |
| Interaction Type |
MIRNA - circRNA |
| Identification Method(s) |
psRNATarget |
Interaction Information
| Type |
ncRNA Interactor 1 |
ncRNA Interactor 2 |
| ncRNA ID |
ath-MIR853 |
ath_circ_034518 |
| Category |
MIRNA |
circRNA |
| Coordinate |
3:8346367-8346656(+) |
4:16273502-16274158(+) |
| Interaction Sequence |
UCUGCAACCGGAAAGGGGAGC |
UCUUUUUUUUCAGGUUGCAGA |
| Interaction Site |
1 - 21 |
336 - 356 |
Additional Information
| Unpaired Energy (UPE) |
NA |
| Inhibition Mode |
Translation |
| RNAhybrid MFE |
NA |
| IntaRNA MFE |
NA |
| Degradome Support |
No |
| Allen's Score |
NA |
| Category |
NA |
| Sample IDs |
|