Basic Information


ANNInter ID ANNInter01761
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-MIR5029 URS0002396630_3702
Category siRNA lncRNA
Coordinate 5:12268507-12268697(.) 1:10300334-10375760(+)
Interaction Sequence UCGGGAAUGAGAGAGAACACU AGUUUUCUUUUUCAUUCCCAA
Interaction Site 1 - 21 19019 - 19039

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network