Basic Information


ANNInter ID ANNInter01481
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-MIR405a URS00023912CE_3702
Category siRNA lncRNA
Coordinate 2:9634957-9635113(.) 3:18202499-18269205(+)
Interaction Sequence AUGAUUAAAUGAGUUAUGGGUUGA UCAUUCUACAGCUUGUUUGAUCAU
Interaction Site 1 - 24 18384 - 18407

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network