Basic Information


ANNInter ID ANNInter01449
Interaction Type MIRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-MIR400 URS00023771A1_3702
Category MIRNA lncRNA
Coordinate 1:11785935-11786036(+) 3:11509097-11586604(+)
Interaction Sequence AGUGACUUAUGAUAAUCUCAU AAGAGGUUAUCAUGAGUUAGA
Interaction Site 1 - 21 64929 - 64949

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network