Basic Information
| ANNInter ID | ANNInter01344 |
|---|---|
| Interaction Type | MIRNA - circRNA |
| Identification Method(s) | CleaveLand4;psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-MIR398c | ath_circ_021952 |
| Category | MIRNA | circRNA |
| Coordinate | 5:4694693-4694807(+) | 3:5299160-5299292(+) |
| Interaction Sequence | UGUGUUCUCAGGUCACCCCUG | AAGGUGUGACCUGAGAAUCACA |
| Interaction Site | 1 - 20 | 46 - 66 |
Additional Information
| Unpaired Energy (UPE) | -1 |
|---|---|
| Inhibition Mode | Cleavage |
| RNAhybrid MFE | NA |
| IntaRNA MFE | NA |
| Degradome Support | Yes |
| Allen's Score | 4 |
| Category | 0 |
| Sample IDs | SRR17487780; SRR3956083; SRR3956086; SRR6041085 |