Basic Information


ANNInter ID ANNInter01272
Interaction Type MIRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-MIR396b URS00023912CE_3702
Category MIRNA lncRNA
Coordinate 5:13611797-13611931(+) 3:18202499-18269205(+)
Interaction Sequence UUCCACAGCUUUCUUGAACUU AAGUUUGAGGAAGCUAUGGAG
Interaction Site 1 - 21 54680 - 54700

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network