Basic Information
| ANNInter ID |
ANNInter01081 |
| Interaction Type |
MIRNA - circRNA |
| Identification Method(s) |
psRNATarget |
Interaction Information
| Type |
ncRNA Interactor 1 |
ncRNA Interactor 2 |
| ncRNA ID |
ath-MIR393a |
ath_circ_048738 |
| Category |
MIRNA |
circRNA |
| Coordinate |
2:16652100-16652232(+) |
Pt:37884-38042(-) |
| Interaction Sequence |
AUCAUGCUAUCUCUUUGGAUU |
AACCUAAAGCAAUAGCAUGAU |
| Interaction Site |
1 - 21 |
118 - 138 |
Additional Information
| Unpaired Energy (UPE) |
NA |
| Inhibition Mode |
Translation |
| RNAhybrid MFE |
NA |
| IntaRNA MFE |
NA |
| Degradome Support |
No |
| Allen's Score |
NA |
| Category |
NA |
| Sample IDs |
|