Basic Information
| ANNInter ID | ANNInter00920 |
|---|---|
| Interaction Type | MIRNA - circRNA |
| Identification Method(s) | CleaveLand4 |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-MIR2111b | ath_circ_004675 |
| Category | MIRNA | circRNA |
| Coordinate | 5:400358-400524(+) | 1:9947407-9949185(+) |
| Interaction Sequence | AUCCUCGGGAUACAGUUUACC | GGCGAGCUACAUCCCGAGGAU |
| Interaction Site | 1 - 21 | 1717 - 1737 |
Additional Information
| Unpaired Energy (UPE) | NA |
|---|---|
| Inhibition Mode | Cleavage |
| RNAhybrid MFE | NA |
| IntaRNA MFE | NA |
| Degradome Support | Yes |
| Allen's Score | 5 |
| Category | 0 |
| Sample IDs | SRR7652709 |