Basic Information
| ANNInter ID |
ANNInter00365 |
| Interaction Type |
MIRNA - lncRNA |
| Identification Method(s) |
psRNATarget |
Interaction Information
| Type |
ncRNA Interactor 1 |
ncRNA Interactor 2 |
| ncRNA ID |
ath-MIR159c |
URS000241EF5E_3702 |
| Category |
MIRNA |
lncRNA |
| Coordinate |
2:18994632-18994856(+) |
3:13593567-13682963(+) |
| Interaction Sequence |
UUUGGAUUGAAGGGAGCUCC |
GGAUCUCCCUUCAUUCCAAA |
| Interaction Site |
1 - 20 |
85192 - 85211 |
Additional Information
| Unpaired Energy (UPE) |
NA |
| Inhibition Mode |
Cleavage |
| RNAhybrid MFE |
NA |
| IntaRNA MFE |
NA |
| Degradome Support |
No |
| Allen's Score |
NA |
| Category |
NA |
| Sample IDs |
|