Basic Information
| ANNInter ID |
ANNInter00188 |
| Interaction Type |
MIRNA - lncRNA |
| Identification Method(s) |
psRNATarget |
Interaction Information
| Type |
ncRNA Interactor 1 |
ncRNA Interactor 2 |
| ncRNA ID |
ath-MIR156g |
URS00023E04C9_3702 |
| Category |
MIRNA |
lncRNA |
| Coordinate |
2:8412516-8412618(-) |
1:7453571-7536335(+) |
| Interaction Sequence |
CGACAGAAGAGAGUGAGCAC |
GUUUUUAUUCUUUUUUGUCU |
| Interaction Site |
1 - 20 |
75826 - 75845 |
Additional Information
| Unpaired Energy (UPE) |
NA |
| Inhibition Mode |
Cleavage |
| RNAhybrid MFE |
NA |
| IntaRNA MFE |
NA |
| Degradome Support |
No |
| Allen's Score |
NA |
| Category |
NA |
| Sample IDs |
|