Basic Information
| ANNInter ID |
ANNInter00150 |
| Interaction Type |
MIRNA - lncRNA |
| Identification Method(s) |
psRNATarget |
Interaction Information
| Type |
ncRNA Interactor 1 |
ncRNA Interactor 2 |
| ncRNA ID |
ath-MIR156e |
URS00023DE39A_3702 |
| Category |
MIRNA |
lncRNA |
| Coordinate |
5:3867206-3867312(+) |
4:8459598-8499742(+) |
| Interaction Sequence |
UGACAGAAGAGAGUGAGCAC |
CUGCUGCUUCUCUUUUGUUU |
| Interaction Site |
1 - 20 |
25744 - 25763 |
Additional Information
| Unpaired Energy (UPE) |
NA |
| Inhibition Mode |
Cleavage |
| RNAhybrid MFE |
NA |
| IntaRNA MFE |
NA |
| Degradome Support |
No |
| Allen's Score |
NA |
| Category |
NA |
| Sample IDs |
|