Basic Information


ANNInter ID ANNInter00039
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID PPR-At1g63150 URS000236ED70_3702
Category siRNA lncRNA
Coordinate 1:23419396-23421579(+)
Interaction Sequence AACGGAUUAUGUAAGAGAGGU GACUCUCUAAUCUAAUCUGUU
Interaction Site 1 - 21 146112 - 146132

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Translation
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network